Review





Similar Products

human mitochondrial dna monitoring primer  (TaKaRa)
96
TaKaRa human mitochondrial dna monitoring primer
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Human Mitochondrial Dna Monitoring Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human mitochondrial dna monitoring primer/product/TaKaRa
Average 96 stars, based on 1 article reviews
human mitochondrial dna monitoring primer - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
cpas barcode primer 3 kit  (Complete Genomics Inc)
97
Complete Genomics Inc cpas barcode primer 3 kit
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Cpas Barcode Primer 3 Kit, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpas barcode primer 3 kit/product/Complete Genomics Inc
Average 97 stars, based on 1 article reviews
cpas barcode primer 3 kit - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier
reverse primer  (tiangen biotech co)
99
tiangen biotech co reverse primer
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer/product/tiangen biotech co
Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
primer  (tiangen biotech co)
99
tiangen biotech co primer
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer/product/tiangen biotech co
Average 99 stars, based on 1 article reviews
primer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
random primers  (TaKaRa)
96
TaKaRa random primers
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Random Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/random primers/product/TaKaRa
Average 96 stars, based on 1 article reviews
random primers - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
primers aagaaggagatatacatatggccaagtcggaagaaacaac  (TaKaRa)
97
TaKaRa primers aagaaggagatatacatatggccaagtcggaagaaacaac
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Primers Aagaaggagatatacatatggccaagtcggaagaaacaac, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers aagaaggagatatacatatggccaagtcggaagaaacaac/product/TaKaRa
Average 97 stars, based on 1 article reviews
primers aagaaggagatatacatatggccaagtcggaagaaacaac - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier
qrt pcr primers  (Vazyme Biotech Co)
99
Vazyme Biotech Co qrt pcr primers
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Qrt Pcr Primers, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qrt pcr primers/product/Vazyme Biotech Co
Average 99 stars, based on 1 article reviews
qrt pcr primers - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
random primer  (TaKaRa)
96
TaKaRa random primer
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Random Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/random primer/product/TaKaRa
Average 96 stars, based on 1 article reviews
random primer - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
dt primers primescript rt reagent kit  (TaKaRa)
99
TaKaRa dt primers primescript rt reagent kit
Agrimol B induces <t>mitochondrial</t> damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of <t>mtDNA</t> copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.
Dt Primers Primescript Rt Reagent Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dt primers primescript rt reagent kit/product/TaKaRa
Average 99 stars, based on 1 article reviews
dt primers primescript rt reagent kit - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

Image Search Results


Agrimol B induces mitochondrial damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of mtDNA copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.

Journal: Precision Clinical Medicine

Article Title: Agrimol B inhibits pancreatic ductal adenocarcinoma by induction of lethal mitophagy through decreasing mitochondrial transcription termination factor 3

doi: 10.1093/pcmedi/pbag009

Figure Lengend Snippet: Agrimol B induces mitochondrial damage in PDAC cells. (A) Results of label-free quantitative proteomics after Agrimol B treatment for 24 h. (B) Western blot analysis of HADHA, TIM23, and SOD2 in PANC-1 and AsPC-1 cells. (C) Flow cytometric analysis of Fluo-4 AM accumulation in cells treated with or without 45 μmol/l Agrimol B. (D) Representative images of Fluo-4 AM accumulation in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (E) Flow cytometric analysis of mitochondrial ROS accumulation in cells treated with or without 45 μmol/l Agrimol B. (F) Representative images of mitochondrial morphology stained with Annexin V-FITC and MitoTracker Red CMXRos in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. Scale bars, 10 μm. (G) Quantitative RT-PCR analysis of mtDNA copies. (H) ATP levels in PANC-1 and AsPC-1 cells treated with or without 45 μmol/l Agrimol B for 24 h. (I) Mitochondrial morphology was observed via transmission electron microscopy after treatment with or without Agrimol B for 24 h. Scale bars, 500 nm.

Article Snippet: After different transfections, PANC-1 and AsPC-1 cells were seeded in 6-well plates and maintained for 24 h. DNA was extracted according to the manufacturer’s instructions (NucleoSpin Tissue) and mtDNA was detected using the Human Mitochondrial DNA Monitoring Primer Set (Takara).

Techniques: Quantitative Proteomics, Western Blot, Staining, Quantitative RT-PCR, Transmission Assay, Electron Microscopy